Wrong NH tag when outSAMmultNmax flag is set to 1

[y9c]

As mentioned in the docs,

Note that \code{NH:i:} tag in STAR will still report the actual number of loci that the reads map to,

STAR/extras/doc-latex/STARmanual.tex

Line 298 in b2763ed

The \opt{outSAMmultNmax} parameter limits the number of output alignments (SAM lines) for multimappers. For instance, \opt{outSAMmultNmax} \optv{1} will output exactly one SAM line for each mapped read. Note that \code{NH:i:} tag in STAR will still report the actual number of loci that the reads map to, while the the number of reported alignments for a read in the SAM file is \code{min(NH,--outSAMmultNMax)}. If \opt{outSAMmultNmax} is equal to \optv{-1}, all the alignments are output according to the order specified in \opt{outMultimapperOrder} option. If \opt{outSAMmultNmax} is not equal to -1, than top-scoring alignments will always be output first, even for the default \opt{outMultimapperOrder} \optv{Old\_2.4} option.

But when I try to mapped a multiple hit read into the genome. STAR always report NH:i:1, which is not consistent with the docs.

---

The input data:

@test
TTCAACGATTAAAGTCCTACGTGATCTG
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEE

The code:

STAR --runThreadN 1 \ 
     --genomeDir ~/Homo_sapiens.GRCh38.genome \
     --readFilesIn test.fq \
     --alignEndsType EndToEnd \
      --outFilterMatchNmin 15 \
      --outFilterMismatchNmax 5 \
      --outFilterMismatchNoverLmax 0.2 \
      --outFilterMultimapNmax 50 \
      --outSAMmultNmax 1 \
     --outReadsUnmapped Fastx \
     --outSAMattributes NH HI AS nM NM MD jM jI MC \
     --limitBAMsortRAM 1000000000 \
     --outSAMtype BAM SortedByCoordinate \
     --outFileNamePrefix test_star_

Note that outSAMmultNmax is set to 1 in the code above, and the STAR version is 2.7.7a.

But if the outSAMmultNmax flag is set to 5, the result will be ok, and the "NH" tag will be "NH:i:3",

[alexdobin]

Hi @yech1990

this bug was fixed in 2.7.9a release.
Thanks for reporting it!

Cheers
Alex